Autosomal dominant cerebellar ataxias (ADCA) are heterogeneous neurodegenerative diseases characterized by progressive cerebellar ataxia occasionally accompanied with other features, such as pyramidal and extrapyramidal signs, and ophthalmoplegia. A single nucleotide substitution (-16C > T) in the 5-UTR of the puratrophin-1 gene has recently been identified as the putative mutation in patients of families linked to chromosome 16q22.1 (16q-ADCA).[1] The (-16C > T) substitution is unique as disease-causing change for ADCA. It has been speculated that this change might decrease mRNA expression of puratrophin-1, and causes aggregation of its protein in Purkinje cells.[1] This nucleotide change seems to be very frequent in Japanese ADCA families because of a founder effect. Ohata et al. found the (-16C > T) in 51 of 106 ADCA families in the Nagano prefecture.[2] On the other hand, the screening for this mutation in 129 index patients of German ADCA families as well as 269 sporadic and 139 with no sufficient family history, did not reveal any new case, suggesting that this mutation is not prevalent in Europe.[3] These authors also extended their search analyzing the 5-UTR and the coding region of the puratrophin-1 gene on 120 ADCA cases without finding any relevant variant, and therefore concluding that this gene is not a common cause of hereditary ataxia in Germany. Our aim was to further verify the possible presence of the (-16C > T) mutation in Europe in a larger group of ADCA patients. We screened a group of 324 cases with familial SCA. Most were of French (227/324, 70%) or Italian (54/324, 17%) origin and with autosomal dominant inheritance (n = 298 ADCA, n = 26 uncertain transmission); the remaining were Europeans from other countries. Age at onset was 44 ± 14 years (mean ± SD; range 14-79 years). Repeat expansions in the most frequent SCA genes (SCA1, 2, 3, 6, 7, 17, and DRPLA) were excluded in all patients. The (-16C > T) substitution was searched by restriction analysis using the XagI restriction endonuclease (CCTNN/NNNAGG, MBI Fermentas, Vilnius, Lithuania). A 360 bp region (primers 5-CAGCGCGGTTCACACTGAGA and GGCCCTTTCTGACAGGACCTGA) was amplified under standard conditions using Taq Gold (Applied Biosystems, Foster City, CA, USA) and a touch-down protocol with a 62°C final annealing temperature. The presence of the (-16C > T) abolishes one of the two XagI sites present in the amplified product, that is easily analyzed on a 2.0% agarose-TBE1X gel stained with ethidium bromide. We found no patient with the (-16C > T) variant. This result is in agreement with those obtained in patients of German ancestry,[3] and further prove that this mutation is not present among Caucasians. In France and Italy STR-expanded genes account for 40 to 50% SCAs.[4][5] Our findings show that this mutation cannot explain any of the cases for which the responsible gene is still unknown.

The (-16C>T) substitution in the PLEKHG4 gene is not present among European ADCA patients

CAGNOLI, CLAUDIA;BRUSSINO, Alessandro;DI GREGORIO, ELEONORA;BRUSCO, Alfredo;
2007-01-01

Abstract

Autosomal dominant cerebellar ataxias (ADCA) are heterogeneous neurodegenerative diseases characterized by progressive cerebellar ataxia occasionally accompanied with other features, such as pyramidal and extrapyramidal signs, and ophthalmoplegia. A single nucleotide substitution (-16C > T) in the 5-UTR of the puratrophin-1 gene has recently been identified as the putative mutation in patients of families linked to chromosome 16q22.1 (16q-ADCA).[1] The (-16C > T) substitution is unique as disease-causing change for ADCA. It has been speculated that this change might decrease mRNA expression of puratrophin-1, and causes aggregation of its protein in Purkinje cells.[1] This nucleotide change seems to be very frequent in Japanese ADCA families because of a founder effect. Ohata et al. found the (-16C > T) in 51 of 106 ADCA families in the Nagano prefecture.[2] On the other hand, the screening for this mutation in 129 index patients of German ADCA families as well as 269 sporadic and 139 with no sufficient family history, did not reveal any new case, suggesting that this mutation is not prevalent in Europe.[3] These authors also extended their search analyzing the 5-UTR and the coding region of the puratrophin-1 gene on 120 ADCA cases without finding any relevant variant, and therefore concluding that this gene is not a common cause of hereditary ataxia in Germany. Our aim was to further verify the possible presence of the (-16C > T) mutation in Europe in a larger group of ADCA patients. We screened a group of 324 cases with familial SCA. Most were of French (227/324, 70%) or Italian (54/324, 17%) origin and with autosomal dominant inheritance (n = 298 ADCA, n = 26 uncertain transmission); the remaining were Europeans from other countries. Age at onset was 44 ± 14 years (mean ± SD; range 14-79 years). Repeat expansions in the most frequent SCA genes (SCA1, 2, 3, 6, 7, 17, and DRPLA) were excluded in all patients. The (-16C > T) substitution was searched by restriction analysis using the XagI restriction endonuclease (CCTNN/NNNAGG, MBI Fermentas, Vilnius, Lithuania). A 360 bp region (primers 5-CAGCGCGGTTCACACTGAGA and GGCCCTTTCTGACAGGACCTGA) was amplified under standard conditions using Taq Gold (Applied Biosystems, Foster City, CA, USA) and a touch-down protocol with a 62°C final annealing temperature. The presence of the (-16C > T) abolishes one of the two XagI sites present in the amplified product, that is easily analyzed on a 2.0% agarose-TBE1X gel stained with ethidium bromide. We found no patient with the (-16C > T) variant. This result is in agreement with those obtained in patients of German ancestry,[3] and further prove that this mutation is not present among Caucasians. In France and Italy STR-expanded genes account for 40 to 50% SCAs.[4][5] Our findings show that this mutation cannot explain any of the cases for which the responsible gene is still unknown.
2007
22
5
752
753
http://onlinelibrary.wiley.com/doi/10.1002/mds.21389/abstract
ataxia; SCA; PLEKHG4 gene
CAGNOLI C; BRUSSINO A; DI GREGORIO E; BRUSCO A; STEVANIN G; DURR A; BRICE A
File in questo prodotto:
File Dimensione Formato  
46 The 16C_T Substitution is not present_MDS 2007.pdf

Accesso riservato

Descrizione: Paper pubblicato
Tipo di file: PDF EDITORIALE
Dimensione 46.96 kB
Formato Adobe PDF
46.96 kB Adobe PDF   Visualizza/Apri   Richiedi una copia

I documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.

Utilizza questo identificativo per citare o creare un link a questo documento: https://hdl.handle.net/2318/41157
Citazioni
  • ???jsp.display-item.citation.pmc??? 1
  • Scopus 2
  • ???jsp.display-item.citation.isi??? 2
social impact